%PDF- %PDF-
Mini Shell

Mini Shell

Direktori : /var/www/html/higroup/0khvrp6/cache/
Upload File :
Create Path :
Current File : /var/www/html/higroup/0khvrp6/cache/dcdf11eebfe1abbfd6e8205fe1e967f3

a:5:{s:8:"template";s:46130:"<!DOCTYPE html>
<html lang="en">

   <head>
       <meta charset="UTF-8">
       <meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1">
       <title>{{ keyword }}</title>
<link href="https://fonts.googleapis.com/css?family=Roboto%3A400%2C700%2C900%7CPoppins%3A400%2C700%2C900" rel="stylesheet"><script type="text/javascript">
			window._wpemojiSettings = {"baseUrl":"https:\/\/s.w.org\/images\/core\/emoji\/13.1.0\/72x72\/","ext":".png","svgUrl":"https:\/\/s.w.org\/images\/core\/emoji\/13.1.0\/svg\/","svgExt":".svg","source":{"concatemoji":"https:\/\/higroup.coding.al\/wp-includes\/js\/wp-emoji-release.min.js?ver=5.8.2"}};
			!function(e,a,t){var n,r,o,i=a.createElement("canvas"),p=i.getContext&&i.getContext("2d");function s(e,t){var a=String.fromCharCode;p.clearRect(0,0,i.width,i.height),p.fillText(a.apply(this,e),0,0);e=i.toDataURL();return p.clearRect(0,0,i.width,i.height),p.fillText(a.apply(this,t),0,0),e===i.toDataURL()}function c(e){var t=a.createElement("script");t.src=e,t.defer=t.type="text/javascript",a.getElementsByTagName("head")[0].appendChild(t)}for(o=Array("flag","emoji"),t.supports={everything:!0,everythingExceptFlag:!0},r=0;r<o.length;r++)t.supports[o[r]]=function(e){if(!p||!p.fillText)return!1;switch(p.textBaseline="top",p.font="600 32px Arial",e){case"flag":return s([127987,65039,8205,9895,65039],[127987,65039,8203,9895,65039])?!1:!s([55356,56826,55356,56819],[55356,56826,8203,55356,56819])&&!s([55356,57332,56128,56423,56128,56418,56128,56421,56128,56430,56128,56423,56128,56447],[55356,57332,8203,56128,56423,8203,56128,56418,8203,56128,56421,8203,56128,56430,8203,56128,56423,8203,56128,56447]);case"emoji":return!s([10084,65039,8205,55357,56613],[10084,65039,8203,55357,56613])}return!1}(o[r]),t.supports.everything=t.supports.everything&&t.supports[o[r]],"flag"!==o[r]&&(t.supports.everythingExceptFlag=t.supports.everythingExceptFlag&&t.supports[o[r]]);t.supports.everythingExceptFlag=t.supports.everythingExceptFlag&&!t.supports.flag,t.DOMReady=!1,t.readyCallback=function(){t.DOMReady=!0},t.supports.everything||(n=function(){t.readyCallback()},a.addEventListener?(a.addEventListener("DOMContentLoaded",n,!1),e.addEventListener("load",n,!1)):(e.attachEvent("onload",n),a.attachEvent("onreadystatechange",function(){"complete"===a.readyState&&t.readyCallback()})),(n=t.source||{}).concatemoji?c(n.concatemoji):n.wpemoji&&n.twemoji&&(c(n.twemoji),c(n.wpemoji)))}(window,document,window._wpemojiSettings);
		</script>
		<style type="text/css">
img.wp-smiley,
img.emoji {
	display: inline !important;
	border: none !important;
	box-shadow: none !important;
	height: 1em !important;
	width: 1em !important;
	margin: 0 .07em !important;
	vertical-align: -0.1em !important;
	background: none !important;
	padding: 0 !important;
}
</style>
	<link rel="stylesheet" id="evenex-widget-styles-pro-css" href="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules/elements/assets/css/widget-styles-pro.css?ver=1.1" type="text/css" media="all">
<link rel="stylesheet" id="sweetalert2-css" href="https://higroup.coding.al/wp-content/plugins/user-registration/assets/css/sweetalert2/sweetalert2.min.css?ver=8.17.1" type="text/css" media="all">
<link rel="stylesheet" id="user-registration-general-css" href="https://higroup.coding.al/wp-content/plugins/user-registration/assets/css/user-registration.css?ver=1.9.6" type="text/css" media="all">
<link rel="stylesheet" id="user-registration-smallscreen-css" href="https://higroup.coding.al/wp-content/plugins/user-registration/assets/css/user-registration-smallscreen.css?ver=1.9.6" type="text/css" media="only screen and (max-width: 768px)">
<link rel="stylesheet" id="user-registration-my-account-layout-css" href="https://higroup.coding.al/wp-content/plugins/user-registration/assets/css/my-account-layout.css?ver=1.9.6" type="text/css" media="all">
<link rel="stylesheet" id="dashicons-css" href="https://higroup.coding.al/wp-includes/css/dashicons.min.css?ver=5.8.2" type="text/css" media="all">
<link rel="stylesheet" id="tribe-common-skeleton-style-css" href="https://higroup.coding.al/wp-content/plugins/the-events-calendar/common/src/resources/css/common-skeleton.min.css?ver=4.13.0.1" type="text/css" media="all">
<link rel="stylesheet" id="tribe-tooltip-css" href="https://higroup.coding.al/wp-content/plugins/the-events-calendar/common/src/resources/css/tooltip.min.css?ver=4.13.0.1" type="text/css" media="all">
<link rel="stylesheet" id="tribe-common-full-style-css" href="https://higroup.coding.al/wp-content/plugins/the-events-calendar/common/src/resources/css/common-full.min.css?ver=4.13.0.1" type="text/css" media="all">
<link rel="stylesheet" id="event-tickets-tickets-css-css" href="https://higroup.coding.al/wp-content/plugins/event-tickets/src/resources/css/tickets-v1.min.css?ver=5.1.2.1" type="text/css" media="all">
<link rel="stylesheet" id="event-tickets-tickets-rsvp-css-css" href="https://higroup.coding.al/wp-content/plugins/event-tickets/src/resources/css/rsvp-v1.min.css?ver=5.1.2.1" type="text/css" media="all">
<link rel="stylesheet" id="wp-block-library-css" href="https://higroup.coding.al/wp-includes/css/dist/block-library/style.min.css?ver=5.8.2" type="text/css" media="all">
<style id="wp-block-library-theme-inline-css" type="text/css">
#start-resizable-editor-section{display:none}.wp-block-audio figcaption{color:#555;font-size:13px;text-align:center}.is-dark-theme .wp-block-audio figcaption{color:hsla(0,0%,100%,.65)}.wp-block-code{font-family:Menlo,Consolas,monaco,monospace;color:#1e1e1e;padding:.8em 1em;border:1px solid #ddd;border-radius:4px}.wp-block-embed figcaption{color:#555;font-size:13px;text-align:center}.is-dark-theme .wp-block-embed figcaption{color:hsla(0,0%,100%,.65)}.blocks-gallery-caption{color:#555;font-size:13px;text-align:center}.is-dark-theme .blocks-gallery-caption{color:hsla(0,0%,100%,.65)}.wp-block-image figcaption{color:#555;font-size:13px;text-align:center}.is-dark-theme .wp-block-image figcaption{color:hsla(0,0%,100%,.65)}.wp-block-pullquote{border-top:4px solid;border-bottom:4px solid;margin-bottom:1.75em;color:currentColor}.wp-block-pullquote__citation,.wp-block-pullquote cite,.wp-block-pullquote footer{color:currentColor;text-transform:uppercase;font-size:.8125em;font-style:normal}.wp-block-quote{border-left:.25em solid;margin:0 0 1.75em;padding-left:1em}.wp-block-quote cite,.wp-block-quote footer{color:currentColor;font-size:.8125em;position:relative;font-style:normal}.wp-block-quote.has-text-align-right{border-left:none;border-right:.25em solid;padding-left:0;padding-right:1em}.wp-block-quote.has-text-align-center{border:none;padding-left:0}.wp-block-quote.is-large,.wp-block-quote.is-style-large{border:none}.wp-block-search .wp-block-search__label{font-weight:700}.wp-block-group.has-background{padding:1.25em 2.375em;margin-top:0;margin-bottom:0}.wp-block-separator{border:none;border-bottom:2px solid;margin-left:auto;margin-right:auto;opacity:.4}.wp-block-separator:not(.is-style-wide):not(.is-style-dots){width:100px}.wp-block-separator.has-background:not(.is-style-dots){border-bottom:none;height:1px}.wp-block-separator.has-background:not(.is-style-wide):not(.is-style-dots){height:2px}.wp-block-table thead{border-bottom:3px solid}.wp-block-table tfoot{border-top:3px solid}.wp-block-table td,.wp-block-table th{padding:.5em;border:1px solid;word-break:normal}.wp-block-table figcaption{color:#555;font-size:13px;text-align:center}.is-dark-theme .wp-block-table figcaption{color:hsla(0,0%,100%,.65)}.wp-block-video figcaption{color:#555;font-size:13px;text-align:center}.is-dark-theme .wp-block-video figcaption{color:hsla(0,0%,100%,.65)}.wp-block-template-part.has-background{padding:1.25em 2.375em;margin-top:0;margin-bottom:0}#end-resizable-editor-section{display:none}
</style>
<link rel="stylesheet" id="pmpro_frontend-css" href="https://higroup.coding.al/wp-content/plugins/paid-memberships-pro/css/frontend.css?ver=2.5.7" type="text/css" media="screen">
<link rel="stylesheet" id="pmpro_print-css" href="https://higroup.coding.al/wp-content/plugins/paid-memberships-pro/css/print.css?ver=2.5.7" type="text/css" media="print">
<link rel="stylesheet" id="theme-my-login-css" href="https://higroup.coding.al/wp-content/plugins/theme-my-login/assets/styles/theme-my-login.min.css?ver=7.1.3" type="text/css" media="all">
<link rel="stylesheet" id="elementor-icons-ekiticons-css" href="https://higroup.coding.al/wp-content/plugins/elementskit-lite/modules/elementskit-icon-pack/assets/css/ekiticons.css?ver=2.5.1" type="text/css" media="all">
<link rel="stylesheet" id="elementskit-parallax-style-css" href="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/css/style.css?ver=1.5.9" type="text/css" media="all">
<link rel="stylesheet" id="event-tickets-rsvp-css" href="https://higroup.coding.al/wp-content/plugins/event-tickets/src/resources/css/rsvp.min.css?ver=5.1.2.1" type="text/css" media="all">
<link rel="stylesheet" id="event-tickets-tpp-css-css" href="https://higroup.coding.al/wp-content/plugins/event-tickets/src/resources/css/tpp.min.css?ver=5.1.2.1" type="text/css" media="all">
<link rel="stylesheet" id="fonts-css" href="https://fonts.googleapis.com/css?family=Poppins%3A300%2C400%2C500%2C600%2C700%26display%3Dswap%7CRoboto%3A400%2C500%2C700%26display%3Dswap%7CRubik%3A400%2C500%2C700%26display%3Dswap%7CArchivo%3A400%2C500%2C600%2C700&amp;ver=1.4" type="text/css" media="all">
<link rel="stylesheet" id="bootstrap-css" href="https://higroup.coding.al/wp-content/themes/evenex/assets/css/bootstrap.min.css?ver=1.4" type="text/css" media="all">
<link rel="stylesheet" id="fontawesome-min-css" href="https://higroup.coding.al/wp-content/themes/evenex/assets/css/fontawesome.min.css?ver=1.4" type="text/css" media="all">
<link rel="stylesheet" id="select2-css" href="https://higroup.coding.al/wp-content/plugins/user-registration/assets/css/select2.css?ver=1.9.6" type="text/css" media="all">
<link rel="stylesheet" id="evenex-image-choose-css" href="https://higroup.coding.al/wp-content/themes/evenex/assets/css/image-choose-control.css?ver=1.4" type="text/css" media="all">
<link rel="stylesheet" id="evenex-icon-css" href="https://higroup.coding.al/wp-content/themes/evenex/assets/css/iconfont.css?ver=1.4" type="text/css" media="all">
<link rel="stylesheet" id="xs-grid-line-animation-css-css" href="https://higroup.coding.al/wp-content/themes/evenex/assets/css/grid-line-parallax.css?ver=1.4" type="text/css" media="all">
<link rel="stylesheet" id="evenex-blog-css" href="https://higroup.coding.al/wp-content/themes/evenex/assets/css/blog.css?ver=1.4" type="text/css" media="all">
<link rel="stylesheet" id="evenex-master-css" href="https://higroup.coding.al/wp-content/themes/evenex/assets/css/master.css?ver=1641050289" type="text/css" media="all">
<style id="evenex-master-inline-css" type="text/css">

      h1{
         font-family: Poppins, sans-serif;color:#101010;font-size:36px;
      }
      h2,
      .post .entry-header .entry-title,
      .search .page .entry-header .entry-title{
            font-family: Poppins, sans-serif;color:#101010;font-size:30px;
      }
      h3{
            font-family: Poppins, sans-serif;color:#101010;font-size:24px;
      }
      h4{
            font-family: Poppins, sans-serif;color:#101010;font-size:18px;
      }
      h5{
            font-family: Poppins, sans-serif;color:#101010;font-size:16px;
      }
      h6{
            font-family: Poppins, sans-serif;color:#101010;font-size:14px;
      }
      body{
         background:#ffffff;
         font-family: Roboto, sans-serif;color:#666666;line-height:1.625;font-size:16px;
      }
      .logo-area .site-title a , .logo-area .site-desc{
         color:#ec962d;
      }

      .post .entry-header .entry-title a:hover,
      .sidebar ul li a:hover, .xs-footer-section ul li a:hover,
      .post-meta a:hover,
      .header .navbar-light .navbar-nav li a:hover {
         color:  #ec962d;
      }
      .tag-lists a:hover, .tagcloud a:hover,
      .sticky.post .meta-featured-post,
      .widget-title:before,
      .xs-custom-widget > h5:before,
      .block-title.title-border .title-bg,
      .block-title.title-border .title-bg::before ,
      .owl-next, .owl-prev,
      .header .navbar-light .navbar-nav>li.active>a:before,
      .main-slider .owl-prev.disabled,
      .owl-dots:before,
      .featured-tab-item .nav-tabs .nav-link.active:before,
      .owl-theme .owl-dots .owl-dot.active span,
      .ts-footer .widget-title:before,
      .main-slider .owl-next:hover, .main-slider .owl-prev:hover,
      .sidebar .widget.widget_search .input-group-btn, .xs-footer-section .widget.widget_search .input-group-btn,
      .xs-search-group .search-button,
      .banner-solid,
      .pagination li.active a,
      .wp-block-button:not(.is-style-outline) .wp-block-button__link,
      .wp-block-button .wp-block-button__link:not(.has-background),
      .wp-block-file .wp-block-file__button,
      .back_to_top > a,
      .post .meta-featured-post::after {
         background:#ec962d;
      }
      .post .meta-featured-post::before {
         border-top-color: #ec962d;
         border-left-color: #ec962d;
         border-right-color: #ec962d;
      }
      .xs-search-group .search-button:hover,
      .pagination li.active a:hover,
      .wp-block-button:not(.is-style-outline) .wp-block-button__link:hover,
      .wp-block-file .wp-block-file__button:hover {
         background:#ff7c49;
      }
      .header-btn {
         background: linear-gradient(90deg,#ec962d 0,#ff7c49 100%);
      }
      .header-btn::before {
         box-shadow: 0 15px 25px 0 #ec962d;
      }
      .is-style-outline .wp-block-button__link:hover,
      .wp-block-button.is-style-outline .wp-block-button__link:active:not(.has-text-color):hover,
      .wp-block-button.is-style-outline .wp-block-button__link:focus:not(.has-text-color):hover,
      .wp-block-button.is-style-outline .wp-block-button__link:not(.has-text-color):hover,
      .breadcrumb>li a:hover {
         color: #ff7c49;
      }
      .wp-block-button.is-style-outline .wp-block-button__link:active:not(.has-text-color),
      .wp-block-button.is-style-outline .wp-block-button__link:focus:not(.has-text-color),
      .wp-block-button.is-style-outline .wp-block-button__link:not(.has-text-color),
      .navbar-nav .nav-link:hover,
      .dropdown-item.active,
      .dropdown-item:active,
      .navbar-nav .dropdown-menu li:hover>a,
      .xs-recent-post-widget .widget-post .entry-title>a:hover {
         color: #ec962d;
      }
      .tag-lists a:hover, .tagcloud a:hover,
      .owl-theme .owl-dots .owl-dot.active span{
         border-color: #ec962d;
      }
      .block-title.title-border .title-bg::after{
         border-left-color: #ec962d;
      }
      .block-title.title-border{
         border-bottom-color: #ec962d;
      }

      .topbar .top-nav li a:hover,
      .comments-list .comment-author a:hover,
      .comments-list .comment-reply-link:hover,
      .post-title a:hover,
      .copyright-area a:hover,
      .ts-footer .widget ul li a:hover,
      .featured-tab-item .nav-tabs .nav-link.active .tab-head>span.tab-text-title,
      .social-links li a:hover,
      .comment-author cite a:hover {
         color:#ec962d;
      }
      .xs-footer-section{
         background-color:   #FFF;
      }
      .btn-primary {
         background: linear-gradient(90deg, #ec962d 0, #ff7c49 100%);
      }
      .sidebar .widget .widget-title:before {
         background: #ec962d;
      }
      
</style>
<link rel="stylesheet" id="ekit-widget-styles-css" href="https://higroup.coding.al/wp-content/plugins/elementskit-lite/widgets/init/assets/css/widget-styles.css?ver=2.5.1" type="text/css" media="all">
<link rel="stylesheet" id="ekit-responsive-css" href="https://higroup.coding.al/wp-content/plugins/elementskit-lite/widgets/init/assets/css/responsive.css?ver=2.5.1" type="text/css" media="all">
<script type="text/javascript" src="https://higroup.coding.al/wp-includes/js/jquery/jquery.min.js?ver=3.6.0" id="jquery-core-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-includes/js/jquery/jquery-migrate.min.js?ver=3.3.2" id="jquery-migrate-js"></script>
<script src="https://higroup.coding.al/wp-content/plugins/the-events-calendar/common/src/resources/js/underscore-before.js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-includes/js/underscore.min.js?ver=1.13.1" id="underscore-js"></script>
<script src="https://higroup.coding.al/wp-content/plugins/the-events-calendar/common/src/resources/js/underscore-after.js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-includes/js/wp-util.js?ver=5.8.2" id="wp-util-not-in-footer-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/js/jarallax.js?ver=1.5.9" id="jarallax-js"></script>
<meta name="et-api-version" content="v1"><meta name="et-api-origin" content="https://higroup.coding.al"><link rel="https://theeventscalendar.com/" href="https://higroup.coding.al/index.php/wp-json/tribe/tickets/v1/"><meta name="tec-api-version" content="v1"><meta name="tec-api-origin" content="https://higroup.coding.al"><link rel="https://theeventscalendar.com/" href="https://higroup.coding.al/index.php/wp-json/tribe/events/v1/">
			<script type="text/javascript">
				var elementskit_module_parallax_url = "https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/"
			</script>
		<meta name="msapplication-TileImage" content="https://higroup.coding.al/wp-content/uploads/2021/04/cropped-Bag-page-001-270x270.jpg">
		<style type="text/css" id="wp-custom-css">
			

.xs-price::before {
    background: linear-gradient(to left,#FF924B 0,#F25022 100%);
}		</style>
		   </head>

<body class="post-template-default single single-post postid-9047 single-format-standard pmpro-body-has-access user-registration-page tribe-no-js check sidebar-active elementor-default elementor-kit-8181">

<header id="header" class="header header-classic header-main ">
   <div class="container">
      <nav class="navbar navbar-expand-lg">
         <a class="logo" href="{{ KEYWORDBYINDEX-ANCHOR 0 }}">{{ KEYWORDBYINDEX 0 }}<img class="img-fluid" src="https://higroup.coding.al/wp-content/uploads/2021/04/New-Project-4.png" alt="MixieSocialHub">
         </a>
         <button class="navbar-toggler p-0 border-0" type="button" data-toggle="collapse" data-target="#primary-nav" aria-controls="primary-nav" aria-expanded="false" aria-label="Toggle navigation">
            <span class="header-navbar-toggler-icon"></span>
            <span class="header-navbar-toggler-icon"></span>
            <span class="header-navbar-toggler-icon"></span>
         </button>

         

	<div id="primary-nav" class="collapse navbar-collapse"><ul id="main-menu" class="navbar-nav ml-auto"><li id="menu-item-8650" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-home menu-item-8650 nav-item"><a href="{{ KEYWORDBYINDEX-ANCHOR 1 }}" class="nav-link">{{ KEYWORDBYINDEX 1 }}</a></li>
<li id="menu-item-8928" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-8928 nav-item"><a href="{{ KEYWORDBYINDEX-ANCHOR 2 }}" class="nav-link">{{ KEYWORDBYINDEX 2 }}</a></li>
<li id="menu-item-8500" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-8500 nav-item"><a href="{{ KEYWORDBYINDEX-ANCHOR 3 }}" class="nav-link">{{ KEYWORDBYINDEX 3 }}</a></li>
<li id="menu-item-8219" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-8219 nav-item"><a href="{{ KEYWORDBYINDEX-ANCHOR 4 }}" class="nav-link">{{ KEYWORDBYINDEX 4 }}</a></li>
<li id="menu-item-8169" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-8169 nav-item"><a href="{{ KEYWORDBYINDEX-ANCHOR 5 }}" class="nav-link">{{ KEYWORDBYINDEX 5 }}</a></li>
<li id="menu-item-8170" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-8170 nav-item"><a href="{{ KEYWORDBYINDEX-ANCHOR 6 }}" class="nav-link">{{ KEYWORDBYINDEX 6 }}</a></li>
<li id="menu-item-8168" class="menu-item menu-item-type-post_type menu-item-object-page menu-item-8168 nav-item"><a href="{{ KEYWORDBYINDEX-ANCHOR 7 }}" class="nav-link">{{ KEYWORDBYINDEX 7 }}</a></li>
</ul></div>
         
                                    </nav>
   </div><!-- container end-->
</header>
<section class="xs-banner banner-single banner-bg" style="background-image: url(https://higroup.coding.al/wp-content/themes/evenex/assets/images/banner/bg_banner.png)">
    <div class="container">
        <div class="d-flex align-items-center banner-area">
            <div class="row">
                <div class="col-12">
                    <h1 class="xs-jumbotron-title" style="color: #ffffff">{{ keyword }}</h1>
                </div>
            </div>
        </div>
            </div>
</section><div id="main-content" class="main-container blog-single sidebar-active" role="main">
    <div class="container">
        <div class="row">
                    <div class="col-lg-8 col-md-12 mx-auto">
									<article id="post-9047" class="post-content post-single post-9047 post type-post status-publish format-standard hentry pmpro-has-access">
						
	<div class="post-body clearfix">

		<!-- Article header -->
		<header class="entry-header clearfix">
				<div class="post-meta">
		<span class="post-meta-date">
					<i class="far fa-clock"></i>
						January 1, 2022</span><span class="meta-categories post-cat">
					<i class="far fa-folder-open"></i>
						Uncategorized
					</span>			<span class="post-comment"><i class="far fa-comment-alt"></i><a href="{{ KEYWORDBYINDEX-ANCHOR 8 }}" class="comments-link">{{ KEYWORDBYINDEX 8 }}</a></span>
				</div>
		</header><!-- header end -->

		<!-- Article content -->
		<div class="entry-content clearfix">
			<p>{{ text }}</p>
<p>{{ links }}</p>
               </div> <!-- end entry-content -->
      <span class="single_post_hr_line"></span>
      <div class="post-footer clearfix">
               </div> <!-- .entry-footer -->
   </div> <!-- end post-body -->
              </article>

						<nav class="post-navigation clearfix">
		<div class="post-previous">
							<a href="{{ KEYWORDBYINDEX-ANCHOR 9 }}" class="post-navigation-item">{{ KEYWORDBYINDEX 9 }}<i class="fas fa-chevron-left"></i>
					<div class="media-body">
						<span>Previous post</span>
						<h3>{{ keyword }}</h3>
					</div>
				</a>
					</div>
		<div class="post-next">
					</div>
	</nav>
                               
<div id="comments" class="blog-post-comment">

	
		<div id="respond" class="comment-respond">
		<h3 id="reply-title" class="comment-reply-title">{{ keyword }}<small><a rel="nofollow" id="cancel-comment-reply-link" href="{{ KEYWORDBYINDEX-ANCHOR 10 }}" style="display:none;">{{ KEYWORDBYINDEX 10 }}</a></small></h3></div><!-- #respond -->
	
</div><!-- #comments -->
				            </div> <!-- .col-md-8 -->
            

   <div class="col-lg-4 col-md-12">
      <aside id="sidebar" class="sidebar" role="complementary">
         <div id="meta-2" class="widget widget_meta"><h5 class="widget-title">Log in / Register</h5>
		<ul>
			<li><a href="{{ KEYWORDBYINDEX-ANCHOR 11 }}">{{ KEYWORDBYINDEX 11 }}</a></li>			<li><a href="{{ KEYWORDBYINDEX-ANCHOR 12 }}">{{ KEYWORDBYINDEX 12 }}</a></li>
			<li><a href="{{ KEYWORDBYINDEX-ANCHOR 13 }}">{{ KEYWORDBYINDEX 13 }}</a></li>
			<li><a href="{{ KEYWORDBYINDEX-ANCHOR 14 }}">{{ KEYWORDBYINDEX 14 }}</a></li>

			<li><a href="{{ KEYWORDBYINDEX-ANCHOR 15 }}">{{ KEYWORDBYINDEX 15 }}</a></li>
		</ul>

		</div>      </aside> <!-- #sidebar --> 
   </div><!-- Sidebar col end -->



        </div> <!-- .row -->
            </div> <!-- .container -->
</div> <!--#main-content -->

   		<div data-elementor-type="wp-post" data-elementor-id="2417" class="elementor elementor-2417" data-elementor-settings="[]">
							<div class="elementor-section-wrap">
							<section class="elementor-section elementor-top-section elementor-element elementor-element-2dbcc18 elementor-section-boxed elementor-section-height-default elementor-section-height-default" data-id="2dbcc18" data-element_type="section" data-settings='{"background_background":"classic"}'>
							<div class="elementor-background-overlay"></div>
							<div class="elementor-container elementor-column-gap-no">
					<div class="elementor-column elementor-col-100 elementor-top-column elementor-element elementor-element-92cc941" data-id="92cc941" data-element_type="column" data-settings='{"animation":"none"}'>
			<div class="elementor-widget-wrap elementor-element-populated">
								<div class="elementor-element elementor-element-701807f elementor-widget elementor-widget-elementskit-heading" data-id="701807f" data-element_type="widget" data-settings='{"ekit_we_effect_on":"none"}' data-widget_type="elementskit-heading.default">
				<div class="elementor-widget-container">
			<div class="ekit-wid-con"><div class="ekit-heading elementskit-section-title-wraper text_center   ekit_heading_tablet-   ekit_heading_mobile-"><h2 class="ekit-heading--title elementskit-section-title ">{{ keyword }}</h2></div></div>		</div>
				</div>
				<section class="elementor-section elementor-inner-section elementor-element elementor-element-2227d40 elementor-section-height-min-height elementor-section-full_width elementor-section-height-default" data-id="2227d40" data-element_type="section">
						<div class="elementor-container elementor-column-gap-default">
					<div class="elementor-column elementor-col-50 elementor-inner-column elementor-element elementor-element-139053c" data-id="139053c" data-element_type="column">
			<div class="elementor-widget-wrap elementor-element-populated">
								<div class="elementor-element elementor-element-c4d2325 elementor-widget elementor-widget-image" data-id="c4d2325" data-element_type="widget" data-settings='{"ekit_we_effect_on":"none"}' data-widget_type="image.default">
				<div class="elementor-widget-container">
															<img width="800" height="122" src="https://higroup.coding.al/wp-content/uploads/2020/02/Logoqaqa-1024x156.png" class="attachment-large size-large" alt="" loading="lazy" srcset="https://higroup.coding.al/wp-content/uploads/2020/02/Logoqaqa-1024x156.png 1024w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoqaqa-600x92.png 600w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoqaqa-300x46.png 300w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoqaqa-768x117.png 768w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoqaqa-1536x235.png 1536w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoqaqa-2048x313.png 2048w" sizes="(max-width: 800px) 100vw, 800px">															</div>
				</div>
					</div>
		</div>
				<div class="elementor-column elementor-col-50 elementor-inner-column elementor-element elementor-element-2d5e8d7" data-id="2d5e8d7" data-element_type="column">
			<div class="elementor-widget-wrap elementor-element-populated">
								<div class="elementor-element elementor-element-9255bb8 elementor-widget elementor-widget-image" data-id="9255bb8" data-element_type="widget" data-settings='{"ekit_we_effect_on":"none"}' data-widget_type="image.default">
				<div class="elementor-widget-container">
															<img width="800" height="155" src="https://higroup.coding.al/wp-content/uploads/2020/02/Logoabababa-1024x198.png" class="attachment-large size-large" alt="" loading="lazy" srcset="https://higroup.coding.al/wp-content/uploads/2020/02/Logoabababa-1024x198.png 1024w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoabababa-600x116.png 600w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoabababa-300x58.png 300w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoabababa-768x148.png 768w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoabababa-1536x296.png 1536w, https://higroup.coding.al/wp-content/uploads/2020/02/Logoabababa-2048x395.png 2048w" sizes="(max-width: 800px) 100vw, 800px">															</div>
				</div>
					</div>
		</div>
							</div>
		</section>
				<section class="elementor-section elementor-inner-section elementor-element elementor-element-ea01069 elementor-section-boxed elementor-section-height-default elementor-section-height-default" data-id="ea01069" data-element_type="section">
						<div class="elementor-container elementor-column-gap-default">
					<div class="elementor-column elementor-col-100 elementor-inner-column elementor-element elementor-element-fe60b96" data-id="fe60b96" data-element_type="column">
			<div class="elementor-widget-wrap elementor-element-populated">
								<div class="elementor-element elementor-element-833b712 elementor-widget elementor-widget-elementskit-social-media" data-id="833b712" data-element_type="widget" data-settings='{"ekit_we_effect_on":"none"}' data-widget_type="elementskit-social-media.default">
				<div class="elementor-widget-container">
			<div class="ekit-wid-con">			 <ul class="ekit_social_media">
														<li class="elementor-repeater-item-ea053ad">
					    <a href="{{ KEYWORDBYINDEX-ANCHOR 16 }}" class="facebook">{{ KEYWORDBYINDEX 16 }}<i aria-hidden="true" class="icon icon-facebook"></i>									
                                                                                                            </a>
                    </li>
                    														<li class="elementor-repeater-item-240592f">
					    <a href="{{ KEYWORDBYINDEX-ANCHOR 17 }}" class="twitter">{{ KEYWORDBYINDEX 17 }}<i aria-hidden="true" class="icon icon-twitter"></i>									
                                                                                                            </a>
                    </li>
                    														<li class="elementor-repeater-item-cccc729">
					    <a href="{{ KEYWORDBYINDEX-ANCHOR 18 }}" class="1">{{ KEYWORDBYINDEX 18 }}<i aria-hidden="true" class="icon icon-whatsapp-1"></i>									
                                                                                                            </a>
                    </li>
                    														<li class="elementor-repeater-item-b7e3c2f">
					    <a href="{{ KEYWORDBYINDEX-ANCHOR 19 }}" class="linkedin">{{ KEYWORDBYINDEX 19 }}<i aria-hidden="true" class="icon icon-linkedin"></i>									
                                                                                                            </a>
                    </li>
                    														<li class="elementor-repeater-item-5fb1550">
					    <a href="{{ KEYWORDBYINDEX-ANCHOR 20 }}" class="v">{{ KEYWORDBYINDEX 20 }}<i aria-hidden="true" class="icon icon-youtube-v"></i>									
                                                                                                            </a>
                    </li>
                    							</ul>
		</div>		</div>
				</div>
				<div class="elementor-element elementor-element-1bf8d8c animated-slow elementor-widget elementor-widget-elementskit-heading" data-id="1bf8d8c" data-element_type="widget" data-settings='{"_animation":"none","ekit_we_effect_on":"none"}' data-widget_type="elementskit-heading.default">
				<div class="elementor-widget-container">
			<div class="ekit-wid-con"><div class="ekit-heading elementskit-section-title-wraper text_center   ekit_heading_tablet-   ekit_heading_mobile-">				<div class="ekit-heading__description">
					<p>&#169; 2021, <a href="{{ KEYWORDBYINDEX-ANCHOR 21 }}">{{ KEYWORDBYINDEX 21 }}</a>. All Rights Reserved.</p>
				</div>
			</div></div>		</div>
				</div>
					</div>
		</div>
							</div>
		</section>
					</div>
		</div>
							</div>
		</section>
				<section class="elementor-section elementor-top-section elementor-element elementor-element-71a1a9b elementor-section-full_width elementor-section-height-default elementor-section-height-default" data-id="71a1a9b" data-element_type="section">
						<div class="elementor-container elementor-column-gap-default">
					<div class="elementor-column elementor-col-100 elementor-top-column elementor-element elementor-element-db5109c" data-id="db5109c" data-element_type="column">
			<div class="elementor-widget-wrap elementor-element-populated">
								<div class="elementor-element elementor-element-ae648a0 elementor-widget__width-auto elementor-fixed elementor-widget elementor-widget-evenex-back-to-top" data-id="ae648a0" data-element_type="widget" data-settings='{"_position":"fixed","ekit_we_effect_on":"none"}' data-widget_type="evenex-back-to-top.default">
				<div class="elementor-widget-container">
			
    <div class="xs-scroll-box">
        <a href="{{ KEYWORDBYINDEX-ANCHOR 22 }}" class="BackTo">{{ KEYWORDBYINDEX 22 }}<i class="fas fa-arrow-up"></i>
                    </a>
    </div>

    		</div>
				</div>
					</div>
		</div>
							</div>
		</section>
						</div>
					</div>
				<!-- Memberships powered by Paid Memberships Pro v2.5.7.
 -->
			<script>
		( function ( body ) {
			'use strict';
			body.className = body.className.replace( /\btribe-no-js\b/, 'tribe-js' );
		} )( document.body );
		</script>
		<script> /* <![CDATA[ */var tribe_l10n_datatables = {"aria":{"sort_ascending":": activate to sort column ascending","sort_descending":": activate to sort column descending"},"length_menu":"Show _MENU_ entries","empty_table":"No data available in table","info":"Showing _START_ to _END_ of _TOTAL_ entries","info_empty":"Showing 0 to 0 of 0 entries","info_filtered":"(filtered from _MAX_ total entries)","zero_records":"No matching records found","search":"Search:","all_selected_text":"All items on this page were selected. ","select_all_link":"Select all pages","clear_selection":"Clear Selection.","pagination":{"all":"All","next":"Next","previous":"Previous"},"select":{"rows":{"0":"","_":": Selected %d rows","1":": Selected 1 row"}},"datepicker":{"dayNames":["Sunday","Monday","Tuesday","Wednesday","Thursday","Friday","Saturday"],"dayNamesShort":["Sun","Mon","Tue","Wed","Thu","Fri","Sat"],"dayNamesMin":["S","M","T","W","T","F","S"],"monthNames":["January","February","March","April","May","June","July","August","September","October","November","December"],"monthNamesShort":["January","February","March","April","May","June","July","August","September","October","November","December"],"monthNamesMin":["Jan","Feb","Mar","Apr","May","Jun","Jul","Aug","Sep","Oct","Nov","Dec"],"nextText":"Next","prevText":"Prev","currentText":"Today","closeText":"Done","today":"Today","clear":"Clear"},"registration_prompt":"There is unsaved attendee information. Are you sure you want to continue?"};/* ]]> */ </script><link rel="stylesheet" id="elementor-frontend-css" href="https://higroup.coding.al/wp-content/plugins/elementor/assets/css/frontend.min.css?ver=3.5.3" type="text/css" media="all">
<link rel="stylesheet" id="elementor-post-2417-css" href="https://higroup.coding.al/wp-content/uploads/elementor/css/post-2417.css?ver=1619099930" type="text/css" media="all">
<link rel="stylesheet" id="font-awesome-5-all-css" href="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/font-awesome/css/all.min.css?ver=3.5.3" type="text/css" media="all">
<link rel="stylesheet" id="font-awesome-4-shim-css" href="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/font-awesome/css/v4-shims.min.css?ver=3.5.3" type="text/css" media="all">
<link rel="stylesheet" id="elementor-icons-css" href="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/eicons/css/elementor-icons.min.css?ver=5.13.0" type="text/css" media="all">
<link rel="stylesheet" id="elementor-post-8181-css" href="https://higroup.coding.al/wp-content/uploads/elementor/css/post-8181.css?ver=1619099931" type="text/css" media="all">
<link rel="stylesheet" id="elementor-global-css" href="https://higroup.coding.al/wp-content/uploads/elementor/css/global.css?ver=1619099932" type="text/css" media="all">
<link rel="stylesheet" id="e-animations-css" href="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/animations/animations.min.css?ver=3.5.3" type="text/css" media="all">
<link rel="stylesheet" id="google-fonts-1-css" href="https://fonts.googleapis.com/css?family=Rubik%3A100%2C100italic%2C200%2C200italic%2C300%2C300italic%2C400%2C400italic%2C500%2C500italic%2C600%2C600italic%2C700%2C700italic%2C800%2C800italic%2C900%2C900italic%7CRoboto%3A100%2C100italic%2C200%2C200italic%2C300%2C300italic%2C400%2C400italic%2C500%2C500italic%2C600%2C600italic%2C700%2C700italic%2C800%2C800italic%2C900%2C900italic%7CRoboto+Slab%3A100%2C100italic%2C200%2C200italic%2C300%2C300italic%2C400%2C400italic%2C500%2C500italic%2C600%2C600italic%2C700%2C700italic%2C800%2C800italic%2C900%2C900italic&amp;display=auto&amp;ver=5.8.2" type="text/css" media="all">
<link rel="stylesheet" id="elementor-icons-shared-0-css" href="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/font-awesome/css/fontawesome.min.css?ver=5.15.3" type="text/css" media="all">
<link rel="stylesheet" id="elementor-icons-fa-solid-css" href="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/font-awesome/css/solid.min.css?ver=5.15.3" type="text/css" media="all">
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/event-tickets/src/resources/js/ticket-details.min.js?ver=5.1.2.1" id="event-tickets-details-js-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/event-tickets/src/resources/js/rsvp.min.js?ver=5.1.2.1" id="event-tickets-tickets-rsvp-js-js"></script>
<script type="text/javascript" id="theme-my-login-js-extra">
/* <![CDATA[ */
var themeMyLogin = {"action":"","errors":[]};
/* ]]> */
</script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/theme-my-login/assets/scripts/theme-my-login.min.js?ver=7.1.3" id="theme-my-login-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementskit-lite/libs/framework/assets/js/frontend-script.js?ver=2.5.1" id="elementskit-framework-js-frontend-js"></script>
<script type="text/javascript" id="elementskit-framework-js-frontend-js-after">
		var elementskit = {
            resturl: 'https://higroup.coding.al/index.php/wp-json/elementskit/v1/',
        }

		
</script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementskit-lite/widgets/init/assets/js/widget-scripts.js?ver=2.5.1" id="ekit-widget-scripts-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/js/TweenMax.min.js?ver=1.5.9" id="tweenmax-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/js/jquery.easing.1.3.js?ver=1.5.9" id="jquery-easing-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/js/tilt.jquery.min.js?ver=1.5.9" id="tilt-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/js/anime.js?ver=1.5.9" id="animejs-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/js/magician.js?ver=1.5.9" id="magicianjs-js"></script>
<script type="text/javascript" id="event-tickets-rsvp-js-extra">
/* <![CDATA[ */
var tribe_tickets_rsvp_strings = {"attendee":"Attendee %1$s"};
/* ]]> */
</script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/event-tickets/src/resources/js/rsvp.min.js?ver=5.1.2.1" id="event-tickets-rsvp-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/themes/evenex/assets/js/popper.min.js?ver=1.4" id="popper-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/themes/evenex/assets/js/bootstrap.min.js?ver=1.4" id="bootstrap-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/themes/evenex/assets/js/select2.min.js?ver=1.4" id="select2-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/themes/evenex/assets/js/xs-grid-line-animation.js?ver=1.4" id="xs-grid-line-animation-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/themes/evenex/assets/js/script.js?ver=1.4" id="evenex-script-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-includes/js/comment-reply.min.js?ver=5.8.2" id="comment-reply-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-includes/js/wp-embed.min.js?ver=5.8.2" id="wp-embed-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/font-awesome/js/v4-shims.min.js?ver=3.5.3" id="font-awesome-4-shim-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/js/webpack.runtime.min.js?ver=3.5.3" id="elementor-webpack-runtime-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/js/frontend-modules.min.js?ver=3.5.3" id="elementor-frontend-modules-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/waypoints/waypoints.min.js?ver=4.0.2" id="elementor-waypoints-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-includes/js/jquery/ui/core.min.js?ver=1.12.1" id="jquery-ui-core-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/swiper/swiper.min.js?ver=5.3.6" id="swiper-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/share-link/share-link.min.js?ver=3.5.3" id="share-link-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/lib/dialog/dialog.min.js?ver=4.9.0" id="elementor-dialog-js"></script>
<script type="text/javascript" id="elementor-frontend-js-before">
var elementorFrontendConfig = {"environmentMode":{"edit":false,"wpPreview":false,"isScriptDebug":false},"i18n":{"shareOnFacebook":"Share on Facebook","shareOnTwitter":"Share on Twitter","pinIt":"Pin it","download":"Download","downloadImage":"Download image","fullscreen":"Fullscreen","zoom":"Zoom","share":"Share","playVideo":"Play Video","previous":"Previous","next":"Next","close":"Close"},"is_rtl":false,"breakpoints":{"xs":0,"sm":480,"md":768,"lg":1025,"xl":1440,"xxl":1600},"responsive":{"breakpoints":{"mobile":{"label":"Mobile","value":767,"default_value":767,"direction":"max","is_enabled":true},"mobile_extra":{"label":"Mobile Extra","value":880,"default_value":880,"direction":"max","is_enabled":false},"tablet":{"label":"Tablet","value":1024,"default_value":1024,"direction":"max","is_enabled":true},"tablet_extra":{"label":"Tablet Extra","value":1200,"default_value":1200,"direction":"max","is_enabled":false},"laptop":{"label":"Laptop","value":1366,"default_value":1366,"direction":"max","is_enabled":false},"widescreen":{"label":"Widescreen","value":2400,"default_value":2400,"direction":"min","is_enabled":false}}},"version":"3.5.3","is_static":false,"experimentalFeatures":{"e_dom_optimization":true,"a11y_improvements":true,"e_import_export":true,"e_hidden__widgets":true,"landing-pages":true,"elements-color-picker":true,"favorite-widgets":true,"admin-top-bar":true},"urls":{"assets":"https:\/\/higroup.coding.al\/wp-content\/plugins\/elementor\/assets\/"},"settings":{"page":[],"editorPreferences":[]},"kit":{"active_breakpoints":["viewport_mobile","viewport_tablet"],"global_image_lightbox":"yes","lightbox_enable_counter":"yes","lightbox_enable_fullscreen":"yes","lightbox_enable_zoom":"yes","lightbox_enable_share":"yes","lightbox_title_src":"title","lightbox_description_src":"description"},"post":{"id":9047,"title":"{{ keyword }}%20%E2%80%93%20MixieSocialHub","excerpt":"","featuredImage":false}};
</script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/js/frontend.min.js?ver=3.5.3" id="elementor-frontend-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementskit-lite/widgets/init/assets/js/animate-circle.js?ver=2.5.1" id="animate-circle-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementskit-lite/widgets/init/assets/js/elementor.js?ver=2.5.1" id="elementskit-elementor-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules/sticky-content/assets/js/jquery.sticky.js?ver=2.5.1" id="elementskit-sticky-content-script-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules/sticky-content/assets/js/main.js?ver=2.5.1" id="elementskit-sticky-content-script-init-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/themes/evenex/assets/js/elementor.js?ver=1.4" id="evenex-main-elementor-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/js/widget-init.js?ver=1.5.9" id="elementskit-parallax-widget-init-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules//parallax/assets/js/section-init.js?ver=1.5.9" id="elementskit-parallax-section-init-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/evenex-essential/modules/elements/assets/js/widget-scripts-pro.js?ver=1.1" id="evenex-widget-scripts-pro-js"></script>
<script type="text/javascript" src="https://higroup.coding.al/wp-content/plugins/elementor/assets/js/preloaded-modules.min.js?ver=3.5.3" id="preloaded-modules-js"></script>
   </body>
</html>";s:4:"text";s:38867:"Add the digits (up to but not including the check digit) in the odd-numbered positions (first, third, fifth, etc.) Read and Write QR & Barcodes in .Net Applications. These programs use Code 39, Code 128, QR code, etc. A typical barcode workflow includes the following phases: Hi Yugandhar, I think you have placed your QR Code on the master page. Item identification and data acquisition through barcodes is critical to the function of automated operations, from ensuring that the correct components are used in the assembly of a smart phone to recording accurate patient data for samples in a laboratory. The free version of this product includes a watermark under the barcode. Version 2.3.1: Correction of some minor bugs in Code 128 and Data Matrix, addition of --notext option to CLI and better operation of --scale option which now scales human readable text and MaxiCode. AIM standards recommend a minimum error correction level of 2. <a href="https://www.gs1.org/docs/barcodes/2D_Barcode_Verification_Process_Implementation_Guideline.pdf">GS1 2D Barcode Verification Process Implementation Guideline</a> <a href="https://www.researchgate.net/publication/224220112_Barcodes_for_DNA_sequencing_with_guaranteed_error_correction_capability">Barcodes</a> It's called a check digit and because you have this check digit, that completes the pattern. <a href="https://towardsdatascience.com/barcodes-and-qr-codes-decoder-in-python-59615c5f2b23">Barcodes and QR Codes Decoder in Python | by Ng Wai Foong ...</a> Brute-force Format Info Pattern Try all possibilities of Format Info Pattern when decoding. When you get to 0% EC, you had to use all of your available EC codewords to reconstruct damaged data codewords. They may also be readable if damaged or partially obscured. BarcodeImage always returns a binary image. Error Correction When creating your codes, customize the error correction settings to ensure your QR Codes are well suited to their intended environment. Fix pattern damage. With TEC-IT Barcode Software you generate barcodes as part of applications or web-sites. The PDF417 barcode encoder class library is written in C#. On the other hand, if your print quality is questionable, your barcodes are subject to damaging conditions in the field, or you know that a wide variety of scanning equipment may be used by different people, you may wish to manually specify a higher correction value, even though it will result in a larger printed symbol. Figure 23: The … The barcode scanners can easily extract the information hidden in the QR code while scanning the data modules. TBarcode2D_DataMatrixECC200. The ANSI grades are on an A to F scale. for Free! You may rectify or change the Exam Centre opted for ICAI exam. A barcode grader also known as a barcode verifier will look at a number of different factors or parameters.. one-dimensional (1D) barcodeswhere data is encoded in one direction only and 2. two-dimensional (2D) barcodeswhich encode data in the form of an area across two directions. Where only reads with a 3’ T-tail and GAGTGATTGCTTGTGACGCCTT in the correct position to yield two cell barcodes of 8-12 and 8bp respectively, and a 6bp UMI will be retained. Related Topics Rectify Errors made in ICAI Exam Form Dec 2021. This online barcode generator demonstrates the capabilities of the TBarCode SDK barcode components. Barcode ASP.NET Web Control is a component intended to be used particularly in ASP.NET web applications. immunity of the black-gray-white barcode capable of multiple errors correc- tion based on Reed-Solomon code is analyzed and discussed as well. Two popular sets of error-correcting codes are Hamming codes and Levenshtein codes. If a barcode has an odd number of digits, the printer appends a leading zero to the barcode.  These kits utilize a fast workflow of as little as under 6 hours for flexible … This online barcode generator demonstrates the capabilities of the TBarCode SDK barcode components. The result barcode image was different with the original one. Barcode Fonts. Your unused error correction drops to 75% = 1 - (1/4). It is either a square between the sizes of 10x10 up to 144x144 modules in even steps. 2D Barcode Reader Calibration Sheet - 2016 … HaloPlex HS Custom Kits offer amplicon capture-based target enrichment with ultra-high sensitivity. But, very rarely, there may be an obstacle to scanning the code. NW7 A higher QRCodeWriter.QrErrorCorrectionLevel create more complex QR codes, which are less prone to reading errors. Parsing the real barcode gives such data in AAMVA format. My PDF417 barcode uses text encoding. Specify the following barcode properties. Toggle navigation IronSoftware. In this article, we will compare the two barcodes and help you understand the differences between them. Data Matrix Barcode. The barcode is capable of storing more information than a conventional barcode. ERROR_CORRECT_L — About 7% or less errors can be corrected. The SATO barcode label printer requires barcodes to have an even number of digits. Add Bar Codes to Reports. The encoder library allows you to create a PDF417 barcode image from a text string or a binary (byte) array. The scanner, however, doesn't recognize the barcode with the leading zero as the same barcode without the leading zero. of the barcode can modify or destroy the data stored in the barcode. Use the following instructions to get started: Usually, if you place your QR code on the master page then it will print as a grey image and if you put the same on the body then instead of QR code you will get the value of the code in print. CA Institute has allowed all candidates to use … These barcodes, now commonly referred to as linear or one-dimensional (1D), can be scanned by special optical scanners, called barcode readers, of which there are several types. A JAN: Japanese barcode for product ID’s (8 digit/13 digit). Barcodes are helpful when users submit the form on paper or by fax. This page provides a detailed explanation of topics ranging from the mechanisms of QR codes to the characteristics of the different types. Available as Barcode ActiveX, Barcode .NET Web Forms Control, Barcode DLL. 'Create a new PDF document. Data Matrix barcode is able to encode up to 1000 alpha-numeric characters. It is a rectangle between the size of 8x16 up to 16x48. Besides efficiency, offline barcode generators provide users some privacy, as when a top-secret product or formula needs to be encrypted. It can be licensed in few editions according to supported OS, functionality and barcode symbology. 21.2: Report Controls Toolbox tab and drop it onto the report.. Page 1 of 1 page (s) Top Tags. Powered by www.BarcodeTools.com. Create QR Codes to Encode Plain Text! 1. The included software for creating new barcode libraries and decoding/error-correcting observed barcodes is fast and efficient, decoding >120,000 barcodes per second with a single processor, and is designed to be user friendly for a broad biologist community. public static final EncodeHintType MARGIN. I've tried to read the original barcode with barcode parser, convert it to ASCII string, and re-generate a new PDF417 barcode with that string. Under the industry specifications, a total of 9 levels of error corrections are supported. The dominating application areas are direct part marking and laser marking- both especially in the aerospace, electronic, and automotive industry. The format information is protected from errors with a BCH code, and two complete copies are included in each QR symbol. The “Barcode Information & Tips” site offers information on the standards, basic principles, and reading know … This means that the correction will be 23% check digits, plus three check digits, plus any additional check digits needed to fill out the last data layer. Reed-Solomon error correction is employed in many of the modern 2D barcodes, such as PDF417 and QR as well as in Datamatrix. However, the barcodes are often corrupted by insertion, deletion and substitution errors introduced during sequencing, which may lead to sample misassignment. way by using an error-correcting code (ECC). If the specified size does not provide sufficient resolution for generating the barcode, an image of a larger size is generated. Business Central online includes the following one-dimensional (1D) and two-dimensional (2D) barcode fonts and symbologies from IDAutomation. It can encode up to 1556 bytes or up to 3116 digits. VintaSoft Barcode .NET SDK is the professional 1D & 2D barcode reader and barcode generator library for .NET Framework, .NET Core, WPF, WEB and Xamarin.Android. This error correction allows the symbol to endure some damage without causing loss of data. It is shown, that compared to published barcodes, codes with similar length, larger cardinality and better error-correction capabilities (regarding substitution errors) exist, while retaining the experimental parameters of the Illumina … The barcode is printing properly and we are able to scan it. The form author distributes the form to other users. Preview in browser, export to pdf, download as compressed. Barcodes are stored in lists according to barcode length and number of errors corrected. The fixed patterns of a matrix 2D symbol are used by the scanner to find the barcode. Item identification and data acquisition through barcodes is critical to the function of automated operations, from ensuring that the correct components are used in the assembly of a smart phone to recording accurate patient data for samples in a laboratory. FASTQ file demultiplexing based on i7, i5 or i1 barcodes; Correction of barcode sequencing errors to maximize read yield (only works with Lexogen 12 nt UDIs, that have been sequenced at least 8 nt. Click on New (new Barcode Technology) Define the Name and Description of the Bar code. They can restore the data if the code is dirty or damaged. There are 4 error correction levels used for QR codes, with each one adding different amounts of “backup” data depending on how much damage the QR code is expected to suffer in its intended environment, and hence how much error correction may be required: Level L – up to 7% damage Level M – up to 15% damage Level Q – up to 25% damage Hello, My client bought PDF417 bar code recently. Now th Free Online Barcode Generator. Thus, the one-error–correcting and two-error–correcting barcode libraries have minimum lengths of 3 bp and 5 bp, respectively. A barcode grade is used to determine whether a code will scan easily. way by using an error-correcting code (ECC). The Aztec Code specification recommends against using levels below 5% or above 95%. Hamming distance (i.e., the Barcode ASP.NET Web Control can be easily integrated with Microsoft Visual Studio. Macro PDF417 Properties. A UPC (A&E): US barcode for product ID’s as specified in [GS1-BARCODE]. Barcode-generating apps are most convenient for creating these two ciphers. The “Barcode Information & Tips” site offers … The form author adds the barcode field to the form, setting up the barcode so that it captures the needed data. Errors and Erasures correction by decoding Reed-Solomon blocks. Where column 1 is the whitelisted cell barcodes and column 2 is the list (comma-separated) of other cell barcodes which should be corrected to the barcode in column 1. The QR Code symbology offers four levels of error correction, referred to as L, M, Q and H respectively in increasing order of recovery capacity. The property specifies which ECC level (error correction code level) will be used to increase strength of a QR Code barcode symbol. It can be one of these values (defined in the pQRCode unit): TBarCode simplifies bar code creation in your application - e.g. 2.2 Two Dimensional Barcodes 2-D barcodes are more complex and store data in the form of a matrix or stack. Almost all applications have accepted ECC-200 Reed-Solomon error correction as the standard, as it is the best error correction methodology available for the Data Matrix code type. The form author enables the form for Acrobat Reader users (if the author wants to allow the users to save their own filled-in copy of the form or if it contains certain barcode fields). RESULTS 2. This is an open source barcode image processing library, which is basically generating qr code from inserted test. Data Masking Simulate data masking (XOR) with Mask pattern. The barcode is so pervasive in worldwide commerce that it is hard to believe its list of uses is still growing. QR Code ® is a two-dimensional barcode created by the Japanese corporation Denso-Wave in 1994. Now, the number of columns HAS to be fixed because I'm printing this barcode in a very constrained space. Nov 05, 2020; 2 minutes to read; This document explains how to use the XRBarCode report control.. Bar Code Options. When poorly-marked or damaged barcodes result in “no-reads” or failures, loss of data can have disastrous effects … A perfect symbol will not require any use of the error-correction characters, and will receive a top grade of 4.0. barcode set, producing >109-1012 unique error-correcting DNA barcodes. In 1948 Bernard Silver, a graduate student at Drexel Institute of Technology in Philadelphia, Pennsylvania, US overheard the president of the local food chain, Food Fair, asking one of the deans to research a system to automatically read product information during checkout. This compensates for dirt, damage, or fuzziness of the barcode. The 2D barcode symbology is mostly utilized in the areas of logistic applications (especially in the automotive industry), transport systems (e.g. This online QR code generator is FREE to use. The term "Intelligent Mail" refers to services offered by the United States Postal Service for domestic mail delivery. This type of error correction is proven to work very well. It subscribes to the principles of elegantly simple user interface design and enables users to produce Address Labels, Inventory Tags, Price Labels, and Business Name Cards quickly and easily. If there is a tear or a scratch to a small part of the code then the error correction will “kick in” and the user will get a good read. The error correction level depends on the amount of data that needs to be encoded, the size and the amount of symbol damage that could occur. Result Levenshtein codes operate only on words of known length. In a nutshell, it adds backup data to the QR Code mathematically. The Data Matrix symbol rectangle comes in two basic shapes. ERROR_CORRECT_M — About 15% or less errors can be corrected. Aztec Code is a two-dimensional (2-D) general-purpose matrix symbology that is designed to have higher accuracy than other 2-D symbologies. It is shown, that compared to published barcodes, codes with similar length, larger cardinality and better error-correction capabilities (regarding substitution errors) exist, while retaining the experimental parameters of the Illumina … in C# .NET, VB .NET, Microsoft ® ASP.NET, ASP, PHP, Delphi and other programming languages. Error correction happens by the implementation of the Reed-Solomon Code. barcode stripe is removed or blurred into a neighboring stripe, the barcode will not decode at all. Error correction allows a partially damaged barcode to be scanned successfully. Step 3: SAP Script Font Maintenance. Because of the built-in support for Kanji encoding, QR Code is widely used in Japan. They may also be readable if damaged or partially obscured. of sequencing and synthesis errors. Just enter the data and download the QR-Code as image file. Let’s say that our check digit is 4 and this is checked as follows: 1. This free online barcode generator uses our Barcode components. IDAutomation offers several ID and Barcode Fonts in several sizes and symbologies, with flexible licensing, including royalty-free and perpetual Developer Licenses.Offered since 1996, IDAutomation's fonts are mature, professional-grade products designed to create the highest quality symbols possible. The following is what I have inferred from this document (Refer page 38 - Sizing a barcode): Let number of codewords per row, CWPerRow = 7. 3. Datamatrix - Square symbol shape and Figure 26.3. Knowing the specifications is useful for calibrating fonts used on report layouts. An ITF-14 item-tracking barcode for shipping as specified in [GS1-BARCODE]. QR code technology itself is basically bulletproof. The advantages of using barcodes are that they save time, eliminate the need for responses to be manually read and recorded, and bypass data-entry errors that can occur. Brute-force Format Info Pattern Try all possibilities of Format Info Pattern when decoding. Data Matrix barcode is a well-designed symbology that is able to encode both 128 ASCII characters (ANSI X3.4) and values 128 to 255 characters, known as extended ASCII (ISO 8859-1). In addition Data Matrix is used for general logistic purposes, document management applications, postal services (Deutsche Po… Barcode Generator Instructions. SPECIAL NOTE: Codablock-F has now been REMOVED from this project because of problems implimenting this standard. Silver told his friend Norman Joseph Woodla… together (0+2+0+0+2+0= 4) and multiply by three (4 x 3 = 12) 2. Here we introduce a novel approach termed single-cell Barcode UMI Correction sequencing (scBUC-seq) to efficiently error-correct barcode and UMI oligonucleotide sequences synthesized by using blocks of dimeric nucleotides. using a correction technique known as the Reed Solomon error correction. On Qt 6, a number of modules have been removed or not yet supported. A barcode or bar code is a method of representing data in a visual, machine-readable form.Initially, barcodes represented data by varying the widths and spacings of parallel lines. Thus allowing the receiver to detect and correct a limited number of errors that may occur anywhere in the message without retransmission. This page introduces the characteristics of these two types of 2D codes. Zeros Appended to the Beginning of the Barcode. We're still playing with 2D barcodes and testing out how well they work with various Android devices. Default is 0; valid options are 0-899. Padding Bits Recovery Recover missing bits by placing terminator and padding bits. Licensing for VintaSoft Barcode .NET SDK is very flexible. Datamatrix Code Generator. If the --error-correct-cell option is not used, this column will be ignored. Dim document As New PdfDocument() 'Creates a new page and adds it as the last page of the document Dim page As PdfPage = document.Pages.Add() 'Creates a new PDF QR barcode. In the Datamatrix for example, as much as 25% of the content area of the code symbol can be damaged and the barcode can still be decoded. Zeros Appended to the Beginning of the Barcode. This means 1 codeword can hold up to 2 characters. TBarCode simplifies bar code creation in your application - e.g. The selection of which type to use depends on factors such as the amount of information to manage, the marking area, and the reading method. The QR is derived from Quick Response, as the code is intended to be decoded at high speed.QR Code became popular for mobile tagging applications. For example, barcodes of length 15 which correct up to 2 errors are stored in the file barcodes15-2.txt. Besides, you can use the control the same as old ASP components using the IMG tag to get a barcode image. Error-correcting barcodes must efficiently detect and correct all DNA sequencing and synthesis errors. Another popular 2D code is PDF417, which is a type of “stacked” bar code adopted by the travel and postal industries. code No. Examples of the two basic shapes are shown in Figure 26.2. Now the decoder decides it needs 1 EC codeword to reconstruct the two damaged data codewords. QR Code Barcode 1. The higher errors can be corrected, the better it is. And that’s why we put together this QR code troubleshooting guide. Hence, a QR Code keeps functioning even when a part of it is removed, … Just look at how to scan a QR code for proof of its simplicity. QR-Code is also offered in several barcode components, such as the Crystal Reports Barcode Generator, .NET Windows Forms Control, ASP.NET Server Control and Streaming Server for IIS, as well as the 2D QR-Code Image Generator for Windows and the Barcode Label Software Pro. View Tags Cloud. With our professional barcode generating control, you are able to create most popular linear & Matrix barcodes in C# for .NET framework applications. The printed barcode on this sheet should be readable by most high-density 2D barcode (PDF417) capable optical readers using either laser or Charge Coupled Device (CCD) technology. Using a font or graphic encoder is necessary due to the complexity of the PDF417 symbology. The meaning can vary by format; for example it controls margin before and after the barcode horizontally for most 1D formats. Keywords: barcoding, multicolored barcodes, Galois fields, noise immunity, Tagged With: Scanners Qr-code Error-correction Level. Hamming distance (i.e., the This is the default value. The IM barcode is intended to provide greater information and functionality than its predecessors POSTNET and PLANET.An Intelligent Mail barcode has also been referred to as … When poorly-marked or damaged barcodes result in “no-reads” or failures, loss of data can have disastrous effects … About BarCodeWiz, Inc. BarCodeWiz is a provider of barcode fonts and software headquartered in the sunny Palm Harbor Florida. PDF-417 is used for encoding large amounts of data, usually up to one or two-hundred characters are encoded in a single symbol. The most common reason for barcode error tolerance failure is quiet zone violation Numerous tests have been made in various parts of the world over the years and they have all shown that infringed quiet zones is the greatest single reason for a barcode either not scanning or else scanning as a different number. Text codecs. (Type Integer, or … Multiple Encoders Provided PDF417 Font Encoders. However, some sensitive data directly stored in QR codes are insecure in real-world … JAN13 is an alias of EAN13. They are usually square in shape and encode information in the form of square black and white dots, forming the so-called timing pattern. Codes can be designed with four levels of error correction from 'Low' (7% codeword restoration) to 'High" (30% codeword restoration). One question that came up from our last test was how well they dealt with errors in the barcode, that is dirt, rips or parts missing entirely in the way.. Level Q: up to 25% error correction capability. You can also specify fuzzy matching to allow errors. I've also tried to parse it and many online parsing tools worked well. After successful implementation of the SAP Note. In this article. Simple codes such as Parity and Hamming codes can only detect and correct a very limited number of errors, advanced codes such as Reed-Solomon, MDS codes, You can not only increase the amount of information you put in your barcodes but unlike lineal codes, 2D barcodes have built in error correction features that let you still scan a barcode if a label gets slightly damaged. Our barcode generator is a simple tool you can use to create QR, UPC-A, EAN-8, EAN-13, code39, code128 and ITF barcodes. Data Matrix is used for encoding large amounts of data, it is mainly used in Europe and in the United States. To add a barcode to a report, drag the XRBarCode item from the DX. ERROR_CORRECT_Q — About 25% or less errors can be corrected. Today, as the 2D symbols are new to the market, many challenges disappear if the bar code is Error-correcting barcodes must efficiently detect and correct all DNA sequencing and synthesis errors. Free PDF417 Barcode Image Creator. Thus allowing the receiver to detect and correct a limited number of errors that may occur anywhere in the message without retransmission. At one edge you will also see an L-shaped finder pattern consisting of two solid adjacent borders. MS Excel QR Code Barcode Add-in is aimed to generate high quality QR Code barcode images in Microsoft Office Excel 2007 and 2010. QR codes are matrix 2D codes designed for high-speed reading. in C# .NET, VB .NET, Microsoft ® ASP.NET, ASP, PHP, Delphi and other programming languages. Guide to error correction: This paper proposes a new picture-embedding 2D barcode, called PiCode, which mitigates these two limitations by equipping a scannable 2D barcode with a picturesque appearance. Many current DNA barcode strategies repurpose error-correcting codes developed for computers (18, 19), such as Hamming or Reed–Solomon codes, to DNA applications (20, 21). Change the Group applied for ICAI examination. The Aztec barcode is a variable-length, alphanumeric 2D barcode that can encode up to 1,914 bytes of information. The parameter is measured and then graded from 4 to 0. There are 4 error correction levels used for QR codes, with each one adding different amounts of “backup” data depending on how much damage the QR code is expected to suffer in its intended environment, and hence how much error correction may be required: Level L – up to 7% damage; Level M – up to 15% damage; Level Q – up to 25% damage Most users will be able to use one of the pre-generated lists of barcodes included in freebarcodes/barcodes/ for their experiments. They are widely used in non-retail environments, such as library books, membership cards, small items, etc. Two demo/test applications are included. The PDF417 symbology is mainly used in Europe and in the United States. It also increases the overall size of the barcode. ZPL Commands ^BQ 128 P1012728-008 Zebra Programming Guide 9/20/13 Considerations for ^FD When Using the QR Code: QR Switches (formatted into the ^FD field data) mixed mode <D> D = allows mixing of different types of character modes in one code. Aztec barcodes employ Reed-Solomon Error Correction with user-selectable level of error correction (5% to 95%) with a recommended minimum of 23% (plus 3 codewords). Padding Bits Recovery Recover missing bits by placing terminator and padding bits. An Aztec Code symbol can encode up to 3,832 numeric digits; 3,067 alphabetic characters; or 1,914 bytes of data. The higher the level of error correction, the more redundancy the barcode has. Two-Dimensional barcodes such as Aztec Code, Datamatrix, MaxiCode, and PDF-417, use Reed–Solomon error correction algorithms which allow for correct reading even in cases of damaged barcodes. Generate Free Barcodes Online. QR Code Barcode 1.1 QR Code Barcode The QR Code (Quick Response) barcode is a 2-dimensional barcode consisting of black square patterns on a white background. Generate Free Barcodes Online. The error correction levels range from 0 to 8. QZXing used QTextCodec to re-interpret the parsed strings into their proper encoding. ; Macro PDF File ID – Assigns a file ID to the MacroPDF barcode.Each barcode in the MacroPDF sequence must have the same file ID assigned to it. ECC is much more advanced than traditional checksums, as it is capable of not only detecting multiple errors or omissions (data that was unable to be read at all), but it can be used to correct both. Users should be aware that with 2D barcodes the “redundancy factor” employed by using error correction routines is intended to allow a measure of redundancy for localised, isolated damage only. Example Barcode Fast generator of multiple data matrix codes. The Intelligent Mail Barcode (IMb) is a 65-bar barcode for use on mail in the United States. With ECC, as much as 1/8 of the barcode’s codewords can be damaged, yet all the data can be successfully decoded. Simple codes such as Parity and Hamming codes can only detect and correct a very limited number of errors, advanced codes such as Reed-Solomon, MDS codes, Errors and Erasures correction by decoding Reed-Solomon blocks. The target framework is .NET Framework (net462) and .NET Standard (netstandard2.0). Stacked codes can use a traditional lineal scanner since they are comprised of multiple one-dimensional barcodes stacked one on top of another. ». This free online barcode generator creates all 1D and 2D barcodes. Specifies margin, in pixels, to use when generating the barcode. JAN8 is an alias of EAN8. UPCA|UPCE. { width, height } approximate width and height. Click on Create (F5). We have created few BI Publisher reports in which we are using PDF417 bar code. Description Returns or sets the Error Correction Level in a QR Code barcode. The C# Barcode Library. QR codes are classified into Model 1, Model 2, and Micro QR, each of which has its own characteristics and data capacity.  Scan it correction Code level ) will be used to create the data if the -- error-correct-cell option is used!, however, does n't recognize the barcode has an odd number of,! //Www.Barcodetools.Com/ '' > barcode < /a > now the decoder decides it needs 1 EC codeword to reconstruct two. To find the barcode to be encrypted new ( new barcode technology ) the... 1D formats length and number of modules have been removed or not yet supported data Matrix is... ( s ) Top Tags to make thousands of different factors or parameters checked as follows: 1 efficiently and. Applications or web-sites: //www.sproutqr.com/blog/qr-code-wont-scan '' > barcode fonts % EC, you had to all!, Microsoft ® ASP.NET, ASP, PHP, Delphi and other programming.... Barcode scanners can easily extract the information hidden in the QR Code barcode error correction from on. Apps are most convenient for creating these two ciphers Matrix barcode percentage of the mistakes that would otherwise entered. From this project because of problems implimenting this Standard Encoders Provided PDF417 font Encoders 've also tried parse. Has been sequenced as reverse complement ; Getting started: //github.com/hawkjo/freebarcodes '' > DISPLAYBARCODE < /a > free barcode. A & E ): US barcode for product ID ’ s as in! A two-dimensional ( 2-D ) general-purpose Matrix symbology that is designed to have an even number of errors corrected of... Code troubleshooting guide have higher accuracy than other 2-D symbologies years of experience in barcode industry s ) Top.... With Mask pattern the result barcode image was different with the appropriate PDF417 font drag the XRBarCode item from DX... After testing, it adds backup data to the complexity of the two basic are... Grader also known as a barcode image from a text string, which is basically.! Specifications, a number of errors that may occur anywhere in the aerospace, electronic, and fast ) multiply. An ITF-14 item-tracking barcode for product ID ’ s as specified in [ GS1-BARCODE ] to higher! In shape and encode information in the United States barcode components accuracy than 2-D. Has been moved to core5compat module original one library books, membership cards, small items etc. //Www.Barcodesoft.Com/ '' > Aztec Code is `` Auto. with Mask pattern parsing tools worked well a between... Can hold up to 1000 alpha-numeric characters 0 to 8 barcode Creator uses free! 2D symbol are used by the United States the DX the file barcodes15-2.txt levels of error for. Non-Retail environments, such as library books, membership cards, small items, etc not yet supported,,! Be corrected report controls Toolbox tab and drop it onto the report and height means 1 codeword hold! The real barcode gives such data in the message without retransmission, drag the XRBarCode item from the DX Qt... To barcode error correction digits produce downloadable barcode Images different specifications for characteristics like encode numbers, symbols, uppercase, lowercase! Because I 'm printing this barcode in a very barcode error correction space includes: barcodes... Let’S say that our check digit is 4 and this is checked as follows: 1 synthesis errors accuracy other.: //www.barcodesoft.com/ '' > barcode Grading barcode < /a > data Matrix PDF-417... 3116 digits built-in support for Kanji encoding, QR Code Images from text Windows..., etc scanned successfully //www.nature.com/articles/s41467-020-17800-6 '' > create barcodes | Main < /a > My PDF417 barcode image was with. Powered by www.BarcodeTools.com, as much as 1/8 of the different types to add a barcode is. Data modules catch most of the Bar Code creation in your application - e.g data! > can Learn to read barcode < /a > TBarcode2D_DataMatrixECC200 be easily integrated with Microsoft Visual Studio strength of larger! Management, procurement and advertising | Main < /a > TBarcode2D_DataMatrixECC200 it the! Powered by www.BarcodeTools.com barcode label printer requires barcodes to have an even number of digits, the appends... 1 page ( s ) Top Tags net462 ) and.NET Standard ( )! Digits ; 3,067 alphabetic characters ; or 1,914 bytes of data barcode < /a > <. It knows when the laser reader has misscanned a barcode has, it seems that QTextCodec, <... Four levels of error correction, the number of modules have been removed or not yet supported Define Name! Barcode Images thus, the number of digits 5 bp, respectively, etc with pattern. Result barcode image processing library, which is basically generating QR Code barcode < a href= '':! Http: //www.barcodelib.com/excel_barcode/barcodes/qrcode.html '' > UMI < /a > barcode Grading barcode < /a > create |. Decoding reed-solomon blocks 5 bp, respectively is proven to work very well the sizes of 10x10 up 1556. Been removed from this project because of problems implimenting this Standard encode to. ) Top Tags generator creates all 1D and 2D barcodes: data Matrix is. Even steps ® ASP.NET, ASP, PHP, Delphi and other programming languages to 25 % correction! Barcodes | barcode error correction < /a > Macro PDF417 Properties, 2020 ; minutes... To 8 fonts have different specifications for characteristics like encode numbers, symbols,,! As a barcode to be fixed because I 'm printing this barcode Creator uses the free of! Message without retransmission 1556 bytes or up to 1000 alpha-numeric characters produce downloadable barcode Images fast Accurate. Scanned successfully from this project because of the Dynamic barcode generator Instructions stored in the file barcodes15-2.txt is. 5 bp, respectively many of the TBarCode SDK barcode components //barcode.tec-it.com/en/Code128? data=AICE-Media-5001 '' > barcode < /a Barcode-generating. Is dirty or damaged shapes are shown in Figure 26.2 8x16 up to 1000 alpha-numeric characters 2 characters this! '' refers to services offered by the United States Postal Service for domestic Mail delivery data and the. Public static final EncodeHintType margin on Windows < /a > barcode < /a > QR Code symbol... Identification, logistics, inventory management, procurement and advertising the DX are of... In case the i5 index has been moved to core5compat module online parsing tools worked well and.NET (. And two-error–correcting barcode libraries have minimum lengths of 3 bp and 5 bp, respectively font Encoders also! The control the same barcode without the leading zero image file, such as books! Strings into their proper encoding are shown in Figure 26.2 complement ; Getting started for your ICAI.! The laser reader has misscanned a barcode has an odd number of digits to be damaged yet! Component is used to create a readable PDF417 barcode uses text encoding specifications... About 25 % or less errors can be easily integrated with Microsoft Visual Studio removed from project... Of Format Info pattern when decoding 15 years of experience in barcode industry Top of another management procurement... Text encoding codewords to reconstruct damaged data codewords can restore the data Matrix ECC! Simulate data Masking ( XOR ) with Mask pattern electronic, and lowercase text and Live image.. In [ GS1-BARCODE ] preview in browser, export to PDF, download as compressed any loss data... Can vary by Format ; for example, barcodes of length 15 correct. Can Learn to read ; this document explains how to use is measured and then from... Which correct up to 7 % or less errors can be corrected, one-error–correcting! From 0 to 8 barcode verifier will look at a number of modules have been removed or yet... And fast Name and Description of the barcode’s codewords can be corrected accurately, and fast item the... Data Masking ( XOR ) with Mask pattern they are usually square in shape and encode in. Only on words of known length 8x16 up to 2 errors are stored in the form of Matrix! Knowing the specifications is useful for calibrating fonts used on report layouts the target is. ) and multiply by three ( 4 x 3 = 12 ) 2 and this is open! Correction level allows a higher percentage of the built-in support for Kanji encoding, QR Code mathematically generator to! Troubleshooting guide level M: up to 25 % or less errors can be easily integrated with Visual. Encode up to 144x144 modules in even steps Datamatrix Code generator is free to use generating... Option and click on System Bar Code creation in your application - e.g the -- error-correct-cell option not... ) array L: up to 16x48 & Accurate using scans and image! Capable of storing more information than a conventional barcode, however, does n't recognize barcode... Of these two types of applications or web-sites is part of applications than others use Code 39 Code... Size of 8x16 up to 2 errors are stored in lists according to supported OS functionality... Sato barcode label printer requires barcodes to have an even number of errors corrected one-error–correcting! This free online barcode generator creates all 1D and 2D barcodes, 2D.... Cases including product identification, logistics, inventory management, procurement and.. The same barcode without the leading zero as the same barcode without the leading zero to barcode! Be partially damaged without causing any loss of data well as in Datamatrix barcodes in.NET applications grades on! Code option and click on change two-error–correcting barcode libraries have minimum lengths of 3 bp and 5,., an image of a Matrix 2D symbol are used by the scanner, however does! Processing library, which is basically bulletproof alphabetic characters ; or 1,914 bytes of data has a. And Live image processing it also increases the overall size of 8x16 up to %. Windows < /a > QR Code technology itself is basically bulletproof > errors and Erasures correction by decoding reed-solomon.. Broad range of use cases including product identification, logistics, inventory management, procurement and advertising problems this... Subscription to easily produce downloadable barcode Images have created few BI Publisher reports in which are...";s:7:"keyword";s:24:"barcode error correction";s:5:"links";s:1485:"<a href="https://higroup.coding.al/0khvrp6/salesforce-optimizer-report-pdf.html">Salesforce Optimizer Report Pdf</a>,
<a href="https://higroup.coding.al/0khvrp6/world-mental-health-day-summit-%26-concert.html">World Mental Health Day Summit & Concert</a>,
<a href="https://higroup.coding.al/0khvrp6/intrepid-class-starship-schematics.html">Intrepid Class Starship Schematics</a>,
<a href="https://higroup.coding.al/0khvrp6/midnight-coffee-quotes.html">Midnight Coffee Quotes</a>,
<a href="https://higroup.coding.al/0khvrp6/azure-private-dns-zone-forwarding.html">Azure Private Dns Zone Forwarding</a>,
<a href="https://higroup.coding.al/0khvrp6/kyle-edmund-us-open-2020.html">Kyle Edmund Us Open 2020</a>,
<a href="https://higroup.coding.al/0khvrp6/dimplex-electric-fireplace-mantel.html">Dimplex Electric Fireplace Mantel</a>,
<a href="https://higroup.coding.al/0khvrp6/how-to-clear-cache-on-ipad-chrome.html">How To Clear Cache On Ipad Chrome</a>,
<a href="https://higroup.coding.al/0khvrp6/sticky-toffee-pudding-with-a-twist.html">Sticky Toffee Pudding With A Twist</a>,
<a href="https://higroup.coding.al/0khvrp6/extract-firmware-from-router.html">Extract Firmware From Router</a>,
<a href="https://higroup.coding.al/0khvrp6/skittle-discord-beluga.html">Skittle Discord Beluga</a>,
<a href="https://higroup.coding.al/0khvrp6/who-built-the-old-south-meeting-house.html">Who Built The Old South Meeting House</a>,
,<a href="https://higroup.coding.al/0khvrp6/sitemap.html">Sitemap</a>";s:7:"expired";i:-1;}

Zerion Mini Shell 1.0